Glyma12g02790 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma12g02790

Feature Type:	gene_model
Chromosome:	Gm12
Start:	1802047
stop:	1802806
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma12g02790

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G16600	AT	Annotation by Michelle Graham. TAIR10: rotamase CYP 3 \| chr2:7200862-7201383 FORWARD LENGTH=173	SoyBase	E_val: 5.00E-110	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003755	GO-mf	Annotation by Michelle Graham. GO Molecular Function: peptidyl-prolyl cis-trans isomerase activity	SoyBase	N/A	ISS
KOG0865	KOG	Cyclophilin type peptidyl-prolyl cis-trans isomerase	JGI		ISS
PTHR11071	Panther	CYCLOPHILIN	JGI		ISS
PTHR11071:SF161	Panther	ROC3 (ROTAMASE CYP 3), PEPTIDYL-PROLYL CIS-TRANS I	JGI		ISS
PF00160	PFAM	Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD	JGI		ISS
UniRef100_I1LPH1	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Peptidyl-prolyl cis-trans isomerase n=1 Tax=Glycine max RepID=I1LPH1_SOYBN	SoyBase	E_val: 1.00E-124	ISS
UniRef100_I1LPH1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Peptidyl-prolyl cis-trans isomerase n=1 Tax=Glycine max RepID=I1LPH1_SOYBN	SoyBase	E_val: 1.00E-124	ISS

Expression Patterns of Glyma12g02790

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma12g02790

Paralog	Evidence	Comments
Glyma11g10480	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma12g02790 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.12g024700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma12g02790

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma12g02790

Limit To All Plant Sequences

>Glyma12g02790.2   sequence type=CDS   gene model=Glyma12g02790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACGAGCATATCCTCAACTCCAAACTCAACCATAGTTACTTTACTTCACTCACACCCCGCCACGTGTTCCAATCGAACGGTCACTTCTGCATCACGCGCCACTATAAATATCTCTCTCTCGTCATCCGCAACCCCAAGCAAAACCCTAATCCCTCTTTCTTCCTCTTCCTCAGTAGTGCGATTTTCGATTCTCTTCTCTGCAACTATGCCTAACCCTAAGGTCTTCTTCGACATGACCATCGGCGGTCAACCTGCCGGCCGCATCGTGATGGAGCTCTACGCCGACGTGACTCCGAGCACCGCCGAGAACTTCCGCGCGCTCTGCACCGGCGAGAAGGGCGCCGGGCGGAGCGGCAAGCCCCTCCACTACAAAGGCTCGTCCTTCCACCGCGTGATCCCGAACTTCATGTGCCAGGGCGGCGACTTCACCGCCGGAAACGGCACCGGAGGCGAGTCGATCTACGGCGCCAAGTTCGCCGACGAGAACTTCGTGAAGAAGCACACTGGTCCCGGCATCCTCTCCATGGCGAACGCCGGTCCCGGAACCAACGGATCTCAGTTCTTCATCTGCACGACGAAGACGGAGTGGCTCGACGGAAAGCACGTCGTGTTCGGACAGGTCGTCGAGGGGATGGACGTCGTCAAGGAGATAGAGAAGGTCGGATCCAGCTCCGGCAGGACCGCCAAGCCTGTCGTCGTCGCCGACTGTGGTCAACTCTCTTAG

Predicted protein sequences of Glyma12g02790

Limit To All Plant Sequences

>Glyma12g02790.2   sequence type=predicted peptide   gene model=Glyma12g02790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTSISSTPNSTIVTLLHSHPATCSNRTVTSASRATINISLSSSATPSKTLIPLSSSSSVVRFSILFSATMPNPKVFFDMTIGGQPAGRIVMELYADVTPSTAENFRALCTGEKGAGRSGKPLHYKGSSFHRVIPNFMCQGGDFTAGNGTGGESIYGAKFADENFVKKHTGPGILSMANAGPGTNGSQFFICTTKTEWLDGKHVVFGQVVEGMDVVKEIEKVGSSSGRTAKPVVVADCGQLS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain